Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST35546
Clone ID OST35546
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST35546
Sequence
TGTAATGTTCAAGCCCAGAAATGCCTTATGTGGATCGACAGAATCGCATCTGTGGATTTCTAGACATTGAAGAAAATGAG
AACAGTGGGAAATTTCTTCGACGGTATTTCATCCTGGATACCAGAGAAGACAGCTTTGTATGGTACATGGATAATCCACA
GGGGCTAGAACCTGGGGCCTCACATGTGCCAGGACCACAGAGCCACACCCATAGTCCTACAATGTTACCTGGATGTCAAA
CCTAGTAAATGTGTAAACTGAATAAAGTATATTTATAAAACGTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI19064

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 138021248..138025745 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040268 (Plekha1) NM_133942 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 Gene [Source:MGI (curated);Acc:Plekha1-002]

 
Come back to gene ENSMUSG00000040268


For any suggestions or comments, please send an email to unitrap@crg.es