Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST35387
Clone ID OST35387
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST35387
Sequence
GCATGTCATGTTGCCCAAGGACATAGCCAAGCTGGTCCCGAAAACCCATCTGATGTCTGAATCTGAATGGAGGAACCTCG
GCGTTCANCAGAGTCAGGGATGGGTCCACTATATGATCCATGAACCAGAACCTCACATCTTACTGTTCCGACGGCCACTG
CCCAAGAAGCCAAAGAAATGAAGCCGGCGAACCGCCTTCCGGCCTCGAGCGGTCCACAGCTGTCCTCACTCCCTGCCATC
TTTCTGATCGCGTGACCATGTTGCTTTCTTATTTCTCACTTTGATATGTAAAGGATACACTGTTTGAATGTGCTGGTACC
TGCTTTGCTTNTGGGAGTTGAGCCNCCAGTGCCACAAGNCCTTGTCAGATGAAGTTGTNGACCTNAAAAGCCCTCGTGTG
A
Sequence Type mRNA
Unitrap ID UNI15502

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89219621..89220323 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028044 (Cks1b) NM_016904 CDC28 protein kinase 1b Gene [Source:MGI (curated);Acc:Cks1b-001]

 
Come back to gene ENSMUSG00000028044


For any suggestions or comments, please send an email to unitrap@crg.es