Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST35305
Clone ID OST35305
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST35305
Sequence
TCAATAAAGGAATTACAATCAGAAGATTATCTTCAGATTATTACAGATGAGGAAGCATTGAAGATAAGAGAGAATGACAA
ATCGCTTTATATCTGTGACCGTTTCAGTGGCACTGTTTTTGATCACCTTAAACAGCTTGGTTGNNNGATTGNNGGNCCTC
AAGTGGTCACATTTTGTATGCGCCACCAGCAATGNGTCCCAAGAGCTGAGCATCCAGTCTACAACATGATAATGTCTGAC
GTAACTGTATCCTGTACAAGCCTGGATAAAGACAAACGGGAAGAAGTTCATAAATACGTACAAATGATGGGTGGACGAGT
TNCNGAGGCCCTNATGGATTCANTCNTCACCTTATTGCAGGAGA
Sequence Type mRNA
Unitrap ID UNI23187

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 103211075..103213909 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032555 (Topbp1) NM_176979 topoisomerase (DNA) II binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1920018]

 
Come back to gene ENSMUSG00000032555


For any suggestions or comments, please send an email to unitrap@crg.es