Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST35137
Clone ID OST35137
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST35137
Sequence
ATATTCAGGAGTTTAACCTANAAAAGGCTCGTCTGGAAGTACACCTGCTTTGGGATCACGGGCTATGGCACAGGAAGAGA
ACGAGTCCTGNAGCGGGAGCGAGCTATCATGCTGGGGGCTAANCCTCCCNAGAACACTTACGTGAACTAC
Sequence Type mRNA
Unitrap ID UNI3637

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 127365254..127366288 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031984 (2810004N23Rik) NM_025615 RIKEN cDNA 2810004N23 gene Gene [Source:MGI Symbol;Acc:MGI:1913773]

 
Come back to gene ENSMUSG00000031984


For any suggestions or comments, please send an email to unitrap@crg.es