Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0041
Clone ID GC0041
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0041
Sequence
CTAGGAGGCTGAGGCTTCTTCTTGGAGGAGGAGGGNGAGTTGGAGGGTGTGGAGAGGTCAG
Sequence Type mRNA
Unitrap ID UNI112

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97237795..97237855 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038485 (Socs7) NM_138657 suppressor of cytokine signaling 4 Gene [Source:MGI (curated);Acc:Socs7-001]

 
Come back to gene ENSMUSG00000038485


For any suggestions or comments, please send an email to unitrap@crg.es