Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RST426
Clone ID RST426
Vector pGT0TMpfs
Project baygenomics

Sequence tag RST426
Sequence
GCTTCAGCGCGGGATCTGCCATCCACTGGCGGGAACCCGAAGGCAAGGAAGTATGGGATTATGTGACTGTCCGAAAGGAT
GCCCACATGTTCTGGTGGCTCTATTATGCCACCAACCCTTGCAAGAACTTTTCAGAGCTGCCCCTGGTCATGTGGCTTCA
GGGTGGTCCGGGTGGTTCTAGCACTGGATTTGGAAACTTTGAGGAAATTGGCCCTCTTGACACCCAACTCAAGCCTCGAA
ATACCACCTGGCTGCAGTGGGCCAGTCTCCTGTTTGTGGATAATCCCGTGGGCACGGGCTTCAGCTACGTCAACACAACA
GATGCCTACGCAAAGGACCTGGACACGGTGGCTTCCGACATGATGGTTCTCCTGAAATCCTTCTTTGATTGCCATAAAGA
ATTCCAGACGGTTCCATTCTACATTTTCTCAGAATCCTACGGAGGAAAGATGGCTGCTGGCATCAGTGTAGAACTTTACA
AGGCTGTTCAGCAAGGGACCATTAAGTGCAACTTTTCTGGGGTTGCTTTGGGTGACTCCTGGATCTCCCCCGTGGATTCA
GTGCTGTCCTGGGGACCTTACCTGTATAGTAT
Sequence Type mRNA
Unitrap ID UNI9186

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88798329..88813869 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000278 (Scpep1) NM_029023 serine carboxypeptidase 1 Gene [Source:MGI (curated);Acc:Scpep1-001]

 
Come back to gene ENSMUSG00000000278


For any suggestions or comments, please send an email to unitrap@crg.es