Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST34982
Clone ID OST34982
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST34982
Sequence
GTTGAAAAGAATGATGAGGACCAAAAGATTGAACAAGATGGTGTCAAGCCGGAAGATAAGGCTCATAAGGCTGCGACCAA
AATTCAGGCTAGCTTCCGTGGACACATAACAAGGAAAAAGCTCAAAGGCGAGAAGAAGGGTGATGCACCAGCTGCTGAGG
CCGAGGCCAAGGAGAAGGATGATGCTCCCGTTGCTGATGGTGTGGAGAAGAAGGAGGGAGATGGCTCTGCTACTACCGAT
GCAGCCCCAGCCACCAGCCCCAAGGCTGAGGAGCCCAGCAAGGCAGGAGATGCACCTTCTGAGGAGAAGAAGGGTGAAGG
GGATGCGGCCCCCTCCGAGGAAAAGGCCGGCTCAGCGGAGACAGAAAGTGCTGCTAAAGCTACCACTGATACTNCCCGTC
CTCAAGGCTGAAGATGGCCCANCCAAGGAGGAGCCTAAACAAAGCCGATGTGCCTGCTTGCTTGTCACTTGATGCTTGCT
GCCACCACCCCTGCTGCAAAAGATGCTTGCCACCAAGGCAGCGCAGCCTTCAACGGAGACTTGCANAAAGCCAGCCAAAC
TTGAGGAGGAAGAAAAGACCCTTTAAACGAAGCCAAANCTTAAGGAAAGTGCCCCCGACANGGATTAAGGGTAAAAGAAA
AAACCCCCGANGGCTTACCCAAGAACATTCCCTTGANCTTTTTAAAAAAAATGGGNTTTTCCCACGGTGGCCCCCCCACC
TTTGNAACCCCTTTGGNNTTTTCCTNGGCCCNTTTTTTAAAGNTTCCCNACTTTTGGAAAATTTTCCCCTTTTTCCCTGG
GCCCTTG
Sequence Type mRNA
Unitrap ID UNI25563

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 41753450..42292479 515
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047261 (Gap43) NM_008083 growth associated protein 43 Gene [Source:MGI (curated);Acc:Gap43-001]

 
Come back to gene ENSMUSG00000047261


For any suggestions or comments, please send an email to unitrap@crg.es