Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST34893
Clone ID OST34893
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST34893
Sequence
ATGAGCACAATGCCAGGACTGCCCACCCGACCCTGCTTTTATGATATAGACCTTGACACAGAAACGGAGCAAGTTAAAGG
CTTGTTCTAATGGAATGAAACCCACAGGACTGGGCAAGANAACAGCTNACACAAGAATCNCATNCTATAACCACTACACA
NGTAANAGNTTAACACCAGAGGAAAAGACNACTNGGCTNTGAGACCCCACCCCCTATTTTTCAGAGNACTTGATACANNA
TACGTNACCTTGCCTTTTTGCTGCNGTTGGAGAANAAAATGAATGNTNNNATCTTGNGATGCAATGCTGGAACAATCCTG
AGACNGGNCTANGACCGCTTCCTNATACGAGATTAACTCTGTTTNCAGCCCATGTGGATGTTCCAC
Sequence Type mRNA
Unitrap ID UNI663

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6190733..6198532 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040675 (Mthfd1l) NM_172308 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like Gene [Source:MGI (curated);Acc:Mthfd1l-003]

 
Come back to gene ENSMUSG00000040675


For any suggestions or comments, please send an email to unitrap@crg.es