Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST34868
Clone ID OST34868
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST34868
Sequence
ATCATCTGTCTGGATCTTTCGGAGGAGATGTCTGTGCCAANGCTGGAGTCCTTTAATGGCTCTAGGACAAACGCCCTGAA
TGTGTCTCAGAAGATGGTTGAGATGTTTGTTCGCACAAAGCACAAGATTGACAAGAGCCACGAATTTGCACTGGTTGTAG
TGAATGACGACTCCGCCTGGCTGTCTGGCCTGACCTCTGACCCACGTGAGCTCTGCAGCTGCCTGTATGACCTGGAGACG
GCGTCCTGCTCCACCTTCAATNTGGAAGGCCTCTTNAGCCTCATNCANCANAAGACCGAGCTGCCAGTCNCAGAGAATGT
GCAAACCATCCCACCCCCCTATGTTGAGCCGCACCCTTCTTGTCTACA
Sequence Type mRNA
Unitrap ID UNI28290

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73922291..73926727 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031820 (5430437P03Rik) NM_026636 RIKEN cDNA 5430437P03 gene Gene [Source:MGI Symbol;Acc:MGI:1915501]

 
Come back to gene ENSMUSG00000031820


For any suggestions or comments, please send an email to unitrap@crg.es