Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST34776
Clone ID OST34776
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST34776
Sequence
ATGTGGTGGCACAGTGGGAGCTATTCTGACATGTCCACTGGAAGTTGTCAAAACACGGCTGCAGTCTTCTTCT
Sequence Type mRNA
Unitrap ID UNI10738

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 97000586..97000658 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032449 (Slc25a36) NM_138756 solute carrier family 25, member 36 Gene [Source:MGI (curated);Acc:Slc25a36-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 8963998..8964070 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000082953 (AL929440.5)  

 
Come back to gene ENSMUSG00000082953


For any suggestions or comments, please send an email to unitrap@crg.es