Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RST477
Clone ID RST477
Vector pGT0TMpfs
Project baygenomics

Sequence tag RST477
Sequence
GGTGGTTGACTCTTACCTGCCTGTCATCCTGGACATGATTAAGGGCGAGATGAGCAACCCTGGGGAAGTGTGCTCTGCGC
TCAACCTCTGCCAGTCCCTTCAGGAGTACTTGGCCGAGCAAAACCAGAAACAGCTTGAGTCCAACAAGATCCCGGAGGTG
GACATGGCCCGTGTGGTTGCCCCCTTCATGTCCAACATCCCTCTCCTGCTGTACCCTCAGGATCACCCCCGCAGCCAGCC
CCAACCTAAGGCTAACGAGGACGTCTGCCAGGACTGTATGAAGCTGGTGTCTGATGTCCAGACTGCTGTGAAGACCAACT
CCAGCTTTATCCAGGGCTTCGTGGACCACGTGAAGGAGGATTGTGACCGCTTGGGGCCAGGCGTGTCTGACATATGCAAG
AACTACGTGGACCAGTATTCCGAGGTCTGTGTCCAGATGTTGATGCACAT
Sequence Type mRNA
Unitrap ID UNI9196

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 59756171..59758749 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004207 (Psap) NM_011179 prosaposin Gene [Source:MGI (curated);Acc:Psap-001]

 
Come back to gene ENSMUSG00000004207


For any suggestions or comments, please send an email to unitrap@crg.es