Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST34587
Clone ID OST34587
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST34587
Sequence
GGATTACATAGGCTCTNAGGCCCAGTACCTCCACACGTTCATGGCCATCACTCATGCTGCAAAAGTGGAGTCGGAGCAAC
ATGGGGACCGCTTACCAAGAGTGGAAATGGCTTTGGAGGCTCTGAGAAATGTGATCAAATACAACCCAGGTTCTGAAAGT
GAATGCATCGGGCACTTTAAGTTAATATTTTCTCTTCTCCGAGTCCATGGAGCTGGTCAAGTGCAGCA
Sequence Type mRNA
Unitrap ID UNI28300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 104074864..104076827 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032560 (Dnajc13) DnaJ (Hsp40) homolog, subfamily C, member 13 Gene [Source:MGI Symbol;Acc:MGI:2676368]

 
Come back to gene ENSMUSG00000032560


For any suggestions or comments, please send an email to unitrap@crg.es