Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST34536
Clone ID OST34536
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST34536
Sequence
CTTTTGAGAGAACTGAAGCACCCTAATGTGATCGCATTGCAGAAGGTGTTCCTTTCTCACAGCGACAGGAAGGTGTGGCT
GCTGTTTGACTATGCAGAACATGACCTTAAAGAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI4982

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 40154110..40154217 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038481 (Cdc2l6) NM_198164 cell division cycle 2-like 6 (CDK8-like) Gene [Source:MGI Symbol;Acc:MGI:1925584]

 
Come back to gene ENSMUSG00000038481


For any suggestions or comments, please send an email to unitrap@crg.es