Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRC094
Clone ID RRC094
Vector pGT1Lxf
Project baygenomics

Sequence tag RRC094
Sequence
TTCCATCTTTAAATCCTGAATATGAGAGAGAACCAAATCAGAATAAATCTTTAGCTGCGGGTGTTTGG
Sequence Type mRNA
Unitrap ID UNI9203

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 112239142..112239207 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032745 (Gpbp1) NM_028487 GC-rich promoter binding protein 1 Gene [Source:MGI (curated);Acc:Gpbp1-002]

 
Come back to gene ENSMUSG00000032745


For any suggestions or comments, please send an email to unitrap@crg.es