Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRC102
Clone ID RRC102
Vector pGT1Lxf
Project baygenomics

Sequence tag RRC102
Sequence
CACCCCCAGACTCCGTTCAGTGAGCTCCTATGGGAAAGTCCGAGCCGTCACGACAGCTAGGAACCTGAACAAATCTTTGC
AGAATCTGAGCTTGACGGAAGAAT
Sequence Type mRNA
Unitrap ID UNI9205

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 119718664..119718767 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025583 (4932417H02Rik) NM_028898 RIKEN cDNA 4932417H02 gene Gene [Source:MGI Symbol;Acc:MGI:1921620]

 
Come back to gene ENSMUSG00000025583


For any suggestions or comments, please send an email to unitrap@crg.es