Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST34460
Clone ID OST34460
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST34460
Sequence
GAAAAGAAGACATGCTGCATAAACAAGGTCAAATGTACACGACAGAGCCACAGATAACTGAACTTCTGAATGATGTCGAA
AGACTAAAGCAGGCGCTCAACGGCCTTTCTCAGCTCACCTACAGCAGTGGCAGCCCCACCAAGCGGCAGAGCCAGCTGGT
GGATACTCTGCAGCAGCGAGTGAGGGATCTGCAGCAGCAGCTGGCTGATGCTGACAGACAGCACCAAGAAGTTATCGCTA
TCTACCGGACACACCTCCTCAGTGCCGCACAGGGCCACATGGATGAAGATGTGCAGGCAGCCCTACTGCAGATCATACAG
ATGCGACAAGGCCTTGTGTGCTAGCGGCAGCTGACTTGGAGCCTGTCCTGCTGGTGCTATGCATTCTGGGTGCAACTCTG
TGCTCTTCTGGGCCTTACTCTGATAGTATCAGTAAAATAAACTATATTTTGNTCCGTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI28305

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 60715239..60728166 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034485 (Uaca) NM_028283 uveal autoantigen with coiled-coil domains and ankyrin repeats Gene [Source:MGI Symbol;Acc:MGI:1919815]

 
Come back to gene ENSMUSG00000034485


For any suggestions or comments, please send an email to unitrap@crg.es