Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST34422
Clone ID OST34422
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST34422
Sequence
GTGGGGTCTTTCAGTAACTGGGTCTGGATAAAGCTGCCTCTTGGCCTACACCTGAAGCCCTCTGACCAGCCTGCCTCACA
CTACAGATTGATGACATTGCTGATGGTGCCGTGAAGCCCCCACCCAACAAATACCCCATCTTCTTCTTTGGAACGCATGA
AACGGCCTTCCTGGGACCCAAGGACCTGTTCCCCTATGATAAGTGCAAGGACAAGTACGGAAAGCCCAACAAGAGGAAAG
GCTTCAATGAGGGGCTCTGGGAGATCCAGAACAACCCCCATGCCAGCTACAGTGTACTTACATA
Sequence Type mRNA
Unitrap ID UNI3694

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56221450..56221830 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002833 (Hdgfrp2) NM_008233 hepatoma-derived growth factor, related protein 2 Gene [Source:MGI Symbol;Acc:MGI:1194492]

 
Come back to gene ENSMUSG00000002833


For any suggestions or comments, please send an email to unitrap@crg.es