Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRC127
Clone ID RRC127
Vector pGT1Lxf
Project baygenomics

Sequence tag RRC127
Sequence
GCGTTAGGATTTGAGCTTGGGCCTTTTGAACCCAGGATCTCGAAATGCATCGTGATTCCTGTCCCTTGGATTGTAAGGTT
TATGTAGGTAATCTTGGAAATAATGGAAACAAGACTGAATTAGAACGGGCTTTTGGCTATTATGGACCACTCAGAAGTGT
GTGGGTTGCTCGAAACCCTCCTGGCTTTGCTTTCGTCGAATTTCAGGATCCCCGAGATGCTGCTGATGCTGTCCGGGAAC
TAGATGGAAGAACACTGTGTGGCTGCCGTGTAAGAGTGGAACTGTCGAATGGTGAAAAGAGAAGTCGGAATCGTGGGCCG
CCTCCCTCTTGGGGTCGTCGTCCTCGAGATGATTACCGCAGGAGGAGTCCTCCACCTCGGCG
Sequence Type mRNA
Unitrap ID UNI9208

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29169690..29175566 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071172 (Sfrs3) NM_013663 splicing factor, arginine/serine-rich 3 (SRp20) Gene [Source:MGI (curated);Acc:Sfrs3-001]

 
Come back to gene ENSMUSG00000071172


For any suggestions or comments, please send an email to unitrap@crg.es