Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRC139
Clone ID RRC139
Vector pGT1Lxf
Project baygenomics

Sequence tag RRC139
Sequence
AGTCTGGACCCAGAATCTTTATATCAACGGACATATGCAGGGAAGATGTCCTTTGGGAGAGTTAGTGATTTGGGGCAGTT
CATCCGAGAGTCTGAGCCTGAACCTGATGTGAAGAAATCAAA
Sequence Type mRNA
Unitrap ID UNI9212

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 61700204..61703780 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047804 (Akap10) NM_019921 A kinase (PRKA) anchor protein 10 Gene [Source:MGI (curated);Acc:Akap10-001]

 
Come back to gene ENSMUSG00000047804


For any suggestions or comments, please send an email to unitrap@crg.es