Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRC150
Clone ID RRC150
Vector pGT1Lxf
Project baygenomics

Sequence tag RRC150
Sequence
CCCCATAGTTTGAATCTCTTTTATCTTGCCAATGATGTCATACAGAATTGTAAACGGAAAAATGCGATCATATTTCGTGA
ATCATTTGCTGATGTGCTTCCTGAAGCAGCTGCTGTAGTGAAGGATCCATCCGTCTCTAAGTCTATAGAGCGAATCTTTA
AAATCTGGGAAGATCGAAATGTGTACCCAGAAGACATGATTGTGGCATTGAGAGAAGCTTTAA
Sequence Type mRNA
Unitrap ID UNI9214

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95591207..95594144 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028106 (Rprd2) NM_001081293 Regulation of nuclear pre-mRNA domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1922387]

 
Come back to gene ENSMUSG00000028106


For any suggestions or comments, please send an email to unitrap@crg.es