Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRC164
Clone ID RRC164
Vector pGT1Lxf
Project baygenomics

Sequence tag RRC164
Sequence
AATGGACCCCTTCTTTCTCCGCAGTCACTAGTGCCAACAGATGTTGATCTTCCTGCGTGTTTCTTCTTGAAATTTCCCCA
GCCAATTCCAGTATATAAAGCATTTGTTCAGAAACTGCAAAATTGCA
Sequence Type mRNA
Unitrap ID UNI9218

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 98028016..98028138 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018160 (Med1) NM_001080118 methyl-CpG binding domain protein 4 Gene [Source:MGI (curated);Acc:Med1-004]

 
Come back to gene ENSMUSG00000018160


For any suggestions or comments, please send an email to unitrap@crg.es