Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST34042
Clone ID OST34042
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST34042
Sequence
GCCCCTAACGGCTAGCAGAGGAACTGTGTCTTGTCATCAGGAACCCCATGCAGCCCGAACCCAAGCTTAGCGGGGCTCCC
CGCAGCAGCCAGTTCCTGCCCCTGTGGTCAAAGTGCCCCGAGGGGGCCGGGGACGCAGTGATGTATGCCTCCACGGAGTG
CAAGGCAGAGGTGACGCCCTCGCAGGACGGTAACCGAACCTTCAGCTACACACTAGAGGATCACACCAAGCAGGCTTTTG
GCGTCATGAACGAGCTTCGCCTGAGCCAGCAACTCTGTGACGTGACCCTGCAGGTCAAATATGAGGACATCCCAGCTGCC
CAATTCATGGCTCACAAAGTGGTGCTGGCCTCCTCCAGCCCAGTCTTTAAAGCCATGTTCACCAACGGGCTTCGGGAGCA
AGGCATGGAAGTTGGTGTCCTTCGAAA
Sequence Type mRNA
Unitrap ID UNI28319

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21041776..21042200 416
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003308 (Keap1) NP_001103777 kelch-like ECH-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1858732]

 
Come back to gene ENSMUSG00000003308


For any suggestions or comments, please send an email to unitrap@crg.es