Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST33871
Clone ID OST33871
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST33871
Sequence
CTCTCCAAGAGGGTGAAGAAGGTGTGGAAGCCACAGCTGTTCACTCGGGAGCTTTACAGTGAAATCCTGGACAAGAAGTT
CACCGTGACTGTGACCATGAGGACCCTGGATCTCATCGATGAGGCCTATGGATTTGACTTCTATATTCTCAAGACCCCTA
AGGAGGACCTGGGCTCCAAGTTTGGCATGNACNNGANGNTACNNATGCTACNAAAGNTNNNTCGNCGGGACCNNCATCTN
CACCCTGAGAACCCTGAGCGGAGAGCAGCCATCTATGACAAGTACAGGAGCTTTGTCATCCCCGAGGCAGAGGCCGAGTG
GGTTGGCCTGACGCTGGAGGAGGCCCTGGAGAAACAGAGGCTTCTGGAGGAAAAGGACCCTGTACCCCTGTTCAAGGTCT
ACGTAGAGGAGCTGGTCCA
Sequence Type mRNA
Unitrap ID UNI18726

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26261501..26263259 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024181 (Mrpl28) NM_024227 mitochondrial ribosomal protein L28 Gene [Source:MGI (curated);Acc:Mrpl28-001]

 
Come back to gene ENSMUSG00000024181


For any suggestions or comments, please send an email to unitrap@crg.es