Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST33864
Clone ID OST33864
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST33864
Sequence
GTGACAGAGCTGAATGAACCACTATCTAACGAAGATCGAAATCTCCTCTCTGTGGCCTACAAGAATGTAGTTGGTGCCAG
GCGATCTTCTTGGAGGGTTATTAGTAGCATTGAGCAGAAAACCATGGCAGATGGGAATGAGAAGAAGTTGGAGAAAGTTA
AAGCCTACCGGGAGAAGATTGAAAAGGAGCTGGAGACAGTTTGCAATGATGTCTTGGCTCTGCTTGACAAGTTCCTTATC
AAGAACTGCAATGATTTTCAGTATGAGAGCAAGGTGTTCTACCTGAAAATGAAGGGCGATTACTACCGCTACCTGGCAGA
GGTGGCTTCTGGGGAGAAGAAAAACAGTGTGGTTGAAGCTTCTGAGGCCGCGTATAAGGAAGCCTTCGAAATCAGCAAAA
GAGCACATGCAGCCAACACACCCC
Sequence Type mRNA
Unitrap ID UNI641

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 33369191..33369613 420
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018965 (Ywhah) NM_011738 tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide Gene [Source:MGI (curated);Acc:Ywhah-001]

 
Come back to gene ENSMUSG00000018965


For any suggestions or comments, please send an email to unitrap@crg.es