Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST33734
Clone ID OST33734
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST33734
Sequence
ACACCATGGAGACGGTGCTGGTCCTCTGCAGCTTGCTGGCCCCTGTGGTCCTGGCGAGTGCAGCTGAGAAGGAGAAAGAA
NAGGATCCTTNCTATTACNACTACCANACACTGANGATTGGGGGGTTGGTGTTTGCTGTGGTCCTCTTCTCCGTTGGGAT
ACTTNTCATCCTCAGTCGCAGATGCAANTGCAGTTNCAATNAGAANCCCANGGCTCCAGGTGACGAAGAGGCCCAGGTGG
AGAACCTCATNACTACAAACGCTGNGGAGCCCCAGAAGGCANANAACTGAGGTGCATCCTCCAGCGNGAANCCTCCAGAA
GCCAANGCCNGCTACCTGACGCTTNAAANACTGATGACGANGCTTNANAAAACCGGCTACTTCATACCANACCTTTTNCT
ANGAAAANCCAANAATGCGTGCTTCCTGTGCCTCTTCCTGCCC
Sequence Type mRNA
Unitrap ID UNI10847

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 45198071..45203197 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066705 (Fxyd6) NM_022004 FXYD domain-containing ion transport regulator 6 Gene [Source:MGI Symbol;Acc:MGI:1890226]

 
Come back to gene ENSMUSG00000066705


For any suggestions or comments, please send an email to unitrap@crg.es