Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST33651
Clone ID OST33651
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST33651
Sequence
GGTCTTCTCTCCTGAAGAATGGCATCCACTTGTCAGAGGCTGAGTTTCTATGTCTCTCCTCTGAAAAGGCAGCTAGTTAG
CAGGCCACCTGTCATCCTGTGGGAAAGACTAATTCCAGGGTGTTCCAGAAGTATCTACAGTGCCACCGGGAAGTGGACAA
AGGAGTACACACTGCAGACAAGGAAGGATGTGGAGAAGTGGTGGCACCAACAGATAAAGGAGCAAGCGTCCAGAGTCTCA
GAGGAAGATAAATTAAAGCCCAAATTCTACTTGCTCTCCATGTTCCCATACCCTTCTGGCAAGCTGCACATGGGCCATGT
CCGTGTCTACACCCTCAGCGACACCATTGCACGGGTCCAGAAAATGAGAGGCATGCAGGTTATCAA
Sequence Type mRNA
Unitrap ID UNI28332

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 123280973..123286949 249
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035202 (Lars2) NM_153168 leucyl-tRNA synthetase, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:2142973]

 
Come back to gene ENSMUSG00000035202


For any suggestions or comments, please send an email to unitrap@crg.es