Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRC235
Clone ID RRC235
Vector pGT1Lxf
Project baygenomics

Sequence tag RRC235
Sequence
CTGAGGAAGAGGGTGGGGCGTAGGCTAAAGACAACCAATAGGAGAGAAGTTATCCTCTATTGAGAAGTGAACACGCCTGG
CCGGACGGGAGGAAAGTATCTGCTCCGCTGAGGGGGGAAAGTAGGAGCAGGAGACAGATTGTGGAGAAAGAGGGGGCCAG
AGGAGTAGAAGTGTGGGGAGAACATGGGCTCTGCTCTGCTTTATGAAATATGGGAGACGACAGACCGTTTGTGTGCAGTG
CCCCGGGCTGTGGACAGAGATTTACAAATGAGGACCACCTGGCAGTTCATAAACATAAGCATGAGATGACACTGAAATTT
GGCCCAGCCCGAACGGACTCAGTCATCATTG
Sequence Type mRNA
Unitrap ID UNI9232

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 102393748..102455917 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052414 (AC137156.3-201) NM_146065 Cyclic AMP-dependent transcription factor ATF-7 (Activating transcription factor 7)(Transcription factor ATF-A) [Source:UniProtKB/Swiss-Prot;Acc:Q8R0S1]

 
Come back to gene ENSMUSG00000052414


For any suggestions or comments, please send an email to unitrap@crg.es