Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRC256
Clone ID RRC256
Vector pGT1Lxf
Project baygenomics

Sequence tag RRC256
Sequence
GTGAAGGGGATGCCAAGGAAAGAGACTTGGAGAGCACCAGTGAGAAGACAGAGGCTAGAGATGAAGACGTGGTAGTGGCT
GAACAGATCGAGAGGCCTGAGCCACAGTCAGACGACGACTCCAGTGCCACTTGCAGTGCGGATGAGGGTGTGGATGGAGA
GCCAGAGAGGCAGAGAGTGTTTCCCATGGATGCAAAGCCTTCATTGTTAACTCCTCCTGGATCTATCCTAATCTCATCCC
CTATTAAACCAAACCCATTGGATCTGCCACAGCTTCAGCATCGAGCTGCTGTTATTCCACCAATGGTTTCTTGCACTCCA
TGTAATATACCAATTGGAACGCCCGTAAGTGGCTATGCTCTTTACCAACGGCACATTAAGGCCATGCATGAGTCAGCACT
CCTGGAGGAGCAGCGGCAGAGGCAAGAACAGGTAGACTTGGAATGCAGAAGCTCTACAAGCCCATGCAGCACTTCTAAGA
GTCCAAACAGGGAGTGGGA
Sequence Type mRNA
Unitrap ID UNI9235

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62180468..62186752 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]

 
Come back to gene ENSMUSG00000018501


For any suggestions or comments, please send an email to unitrap@crg.es