Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST33486
Clone ID OST33486
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST33486
Sequence
TGTGCTGGAGAAGAGAAACGAGTTGGTACACGCACAGTGTTTGTTGGCAATCATCCCATTTCTGGAACAGAACCTTATAT
TGCGCAAAGATTTTGTGATAATAGAATAGTCTCATCTAAGTATACACTTTGGAATTTCCTCCCTAAGAATTTGTTTGAAC
AGTTTAGAAGAATTGCGAATTTTTATTTCCTCATCATTTTCCTTGTACAGGTCACAGTAGACACACCAACCAGCCCAGTT
ACCAGTGGACTTCCACTTTTTTT
Sequence Type mRNA
Unitrap ID UNI6913

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 57562891..57574730 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062949 (Atp11c) NM_001037863 ATPase, class VI, type 11C Gene [Source:MGI Symbol;Acc:MGI:1859661]

 
Come back to gene ENSMUSG00000062949


For any suggestions or comments, please send an email to unitrap@crg.es