Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST33445
Clone ID OST33445
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST33445
Sequence
GTGAATGCAATCTGCTATGGGGCCAAGATCATGCTTCCTGGTCTTCTTCGATATGAAGATGGCATTGAGGTCAACCAGGA
GATTGTGGTCATTACTACTAAGGGGGAAGCTATCTGCATGGCAATTGCATTGATGACTACAGCAGTGATTTCTACCTGTG
ACCATGGTATAGTAGCCAAAATAAAGAGGGTGATCATGGAGAGAGACACTTATCCTCGCAAGTGGGGTTTAGGTCCAAAG
GCAAGTCAGAAGAAGATGATGATCAAGCAGGGCCTTCTGGACAAGCATGGCAAACCCACAGACAATACCCCTGCCACATG
GAAACAGGATTACATTGACTATAGTGATTCTGGCAAGAACACACTGGTTACCGAAGCAGTACAAGCCCCTCAGTTAGCTG
CTGAAGCAGTAAATGTCATAAAAAGGAAGCGGGATAGTGAGAGTGAAAGTGATGAGACCCCAACAGTTCCCCAGTTGAAG
GAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI28343

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 72349679..72352614 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031403 (Dkc1) NM_001030307 dyskeratosis congenita 1, dyskerin homolog (human) Gene [Source:MGI (curated);Acc:Dkc1-001]

 
Come back to gene ENSMUSG00000031403


For any suggestions or comments, please send an email to unitrap@crg.es