Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRC282
Clone ID RRC282
Vector pGT1Lxf
Project baygenomics

Sequence tag RRC282
Sequence
AGCCCATTTTTGTTTTTCTCCTGAGCACCCGGGCAGGTGGAGTGGGCATGAACTTAACAGCGGCAGACACCGTCATTTTT
GTCGACAGCGACTTCAACCCTCAGAATGACTTGCAGGCGGCCGCCAGAGCTCACCGAATTGGCCAGAACAAGTCTGTTAA
AGTCATCCGGCTGATCGGCCGCGACACCGTGGAAGAAATCGTGTATAGGAAGGCGGCCTCCAAACTGCAGCTTACCAACA
TGGTCATAGAAGGAGGTCATTTCACACCAGGAGCCCAGAAACCTTCAGCCGAGGCCGACTTCCAGTTAAGTGAGATTCTC
AAATTCGGCTTGGATAAACTGCTGTCCTCTGAGGGGAGCTCCATGGAGGATATAGACCTGAAGTCCATCCTGGGAGAAAC
CAAAGATGGCCAGTGGACCCCTGATGCTCTGCCCGCAGCAGCAGCAGCAGGAGGAGGAAGCCTAGAACGAGAGGAAGGAA
Sequence Type mRNA
Unitrap ID UNI9211

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 97384926..97391069 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028089 (Chd1l) NM_026539 chromodomain helicase DNA binding protein 1-like Gene [Source:MGI Symbol;Acc:MGI:1915308]

 
Come back to gene ENSMUSG00000028089


For any suggestions or comments, please send an email to unitrap@crg.es