Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRC298
Clone ID RRC298
Vector pGT1Lxf
Project baygenomics

Sequence tag RRC298
Sequence
GATTCAGTGGAGGATTTGGAGCCAGAGACTATCGACAGAGCAGTGGTTCTGCAAATGCTGGATTTAATAGTAACCGTGCC
AATAGCAGCCGATAGTAGTGGTAGTAGCCACAAGCAGAGGATTTGGTGG
Sequence Type mRNA
Unitrap ID UNI8980

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 600015..600141 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069045 (Ddx3y) NM_012008 DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked Gene [Source:MGI Symbol;Acc:MGI:1349406]

 
Come back to gene ENSMUSG00000069045


For any suggestions or comments, please send an email to unitrap@crg.es