Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST33241
Clone ID OST33241
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST33241
Sequence
TTCATGCAAAGAGGCCTGGACTCGGAAACCAAGAAACAGCTAGAAGAGGAGGAGCGGAAGATGATCAGCGACGAGCACTG
GTACCTGGATTTGCCGGAGTTGAAGGAGAAGGAGAGCTTCATCGTAGAGGAGCAGAGCTTCTCCCTGTGTGAAGATCTTC
TCTACGGAAGGATGTCATTCAGGGGGTTTAATCCTGAGGTTGAGGTATTAAATATAATTGCTTCAAATTTGAAAAAAAAA
AA
Sequence Type mRNA
Unitrap ID UNI27228

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 120318446..120323056 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031843 (Mphosph6) NM_026758 M phase phosphoprotein 6 Gene [Source:MGI Symbol;Acc:MGI:1915783]

 
Come back to gene ENSMUSG00000031843


For any suggestions or comments, please send an email to unitrap@crg.es