Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST33122
Clone ID OST33122
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST33122
Sequence
ATTTGTCTTCGGCAAAGCGGAAGTTTGCAGATTCCTTAAATGAATTTAAATTTCAGTGTATAGGAGATGCCGAAACAGAT
GATGAGATGTGTATANNGAGATCTTTGCAAGAATTCGCTGCTGTTCTCAGGAATCTTGAAGACGAGCGGAGTCGAATGAT
CGAGAATGCCAGCGAGGTGCTCATCACACCCTTGGAGAAGTTTCGAAAGGAGCAGATTGGGGCCGCCAGGTTTCATGCCT
CCTCGGACTCAGGCTGATTGGCAGAGTGATGTTGCTTGAGATAGATGCCCATGCTGAAAGAAAACCCGTGCTGGGGCAAG
ACCCGTGGAGAACACGTGATGTTTAGAAGGCGTATAAAAAGGACTTGATGGACAGTGACGGAGGCCGAGCTAGGCATGCT
GGTACAGCTGGCTGTGCAATGCTNGTGGGTCTTTAGTCTCTGCTGATTTTCACTTCCCTGANAGAGGCACAGCCAAGAGC
GCCTCCTGTTCCTCCTGGTACCTCCTGCTGACTGGTGCCTAGGCTAGGTAAGAGAGTGCCACTNCTTGCTGATCCCGNGT
TTGCTATCCTGACTTTTACNAGACCGGACTGCTGGAGGATCTGNNGAAATGGTTTCCAATGGATTGAGCTTGCCNCTTCT
GANTCTGTGGAACNNGAAACTGCCNATTNCTTGACAACNCNGNCCNGGGAGTTGNNTTCCAAAGGAACCCTTTTTTTAAA
ACA
Sequence Type mRNA
Unitrap ID UNI26126

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 39257284..39267757 364
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036452 (Arhgap26) NM_175164 Rho GTPase activating protein 26 Gene [Source:MGI (curated);Acc:Arhgap26-001]

 
Come back to gene ENSMUSG00000036452


For any suggestions or comments, please send an email to unitrap@crg.es