Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XG039
Clone ID XG039
Vector pGT1Lxf
Project baygenomics

Sequence tag XG039
Sequence
AAGGCAATGAAGTCATGACTCCAGATATCTTAGCTAAGAAATTAGCTGCTGCTGAAGGCTCAGAGCCAAAGTATCGGACT
CGGGAGCAAGAAAGTAGTGGAGAGGAAGATAATGACCTCTCCCCTGAGGAGCGAGAAAAGAAGCGACAGTTTGAAATGAA
AAGGAAGCTTCATTACAATGAAGGACTCAATATTAAGTTAGCCAGACAGTTAATTTCAAAAGACCTACATGATGATGA
Sequence Type mRNA
Unitrap ID UNI5443

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31258488..31261355 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047714 (Ppp1r2) NM_025800 protein phosphatase 1, regulatory (inhibitor) subunit 2 Gene [Source:MGI (curated);Acc:Ppp1r2-001]

 
Come back to gene ENSMUSG00000047714


For any suggestions or comments, please send an email to unitrap@crg.es