Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST33014
Clone ID OST33014
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST33014
Sequence
GTTTTGCCTTCAAGATGGCTAGCAAAGCCGAGAAGAAGCGAAAAGTGGCTGGCCGGGGAGGCGCCCGGGCAGGCCGAGTT
GTCCGAGCTCCTCAGTCCACTGCAGGCCCAGGAGCTACAGAGGCTTCCCTGCTCCCTGATGGTCAGGAGCCAGAGCCCGA
GTCTGGCAAGGAGGACTCTGA
Sequence Type mRNA
Unitrap ID UNI18325

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69357879..69358058 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005237 (Dnahc2) NM_001081330 dynein, axonemal, heavy chain 2 Gene [Source:MGI (curated);Acc:Dnahc2-001]

 
Come back to gene ENSMUSG00000005237


For any suggestions or comments, please send an email to unitrap@crg.es