Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST32975
Clone ID OST32975
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST32975
Sequence
TTACTCCGAGAGCTTAAGCACCCAAACGTCATCTCCCTTCTGAAGGTGTTTCTGTCTCATGCTGATCGGAAAGTATGGCT
TCTCTTTGACTATGCTGAGCATGACCTCTGGCATATAATTAAGTTTCACAGAGCTTCGAAAGCCAACAAGAAGCCAGTTC
AGTTACCTCGGGGAATGGTGAAGTCACTGTTGTACCANATCCTANATGGGATTCACTATCTTCATGCCAACTGGGTGTTG
CACAGGGATTTGAAACCTGCTAATATTTTAGTTATGGGTGAAGGTCCTGAGCGAGGAAGAGTAAAAATTGTGACTGCGTG
TGAAGCCGTACAGAGATGAAGCCTCTAAGACTATGGATTAGCAGTACAAAGTTCGTAACCAAGTAGTTTGATGGCGTGGT
ACTGGTGCCAAGAACTCTCCAGTGCCATCTTGGAGACCTAGTTTTGTGGGTTT
Sequence Type mRNA
Unitrap ID UNI28357

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 147079791..147097232 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029635 (Cdk8) NM_153599 cyclin-dependent kinase 8 Gene [Source:MGI (curated);Acc:Cdk8]

 
Come back to gene ENSMUSG00000029635


For any suggestions or comments, please send an email to unitrap@crg.es