Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST32922
Clone ID OST32922
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST32922
Sequence
GACGCCTAGGGAGCCCTCCCTACTCTCTTGAATACCATCAATAAATGTTCGCTGCACCCAA
Sequence Type mRNA
Unitrap ID UNI6921 UNI21470 UNI28193

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20234835..20234891 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078965 (OTTMUSG00000005300) NP_032110 predicted gene, OTTMUSG00000005300 Pseudogene [Source:MGI Symbol;Acc:MGI:3650751]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 99171849..99171905 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12113264..12113320 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079360 (AC158396.2-202) GAPDH Fragment [Source:UniProtKB/TrEMBL;Acc:Q2VWQ4]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 12505771..12505827 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078300 (AC150660.4) Glyceraldehyde-3-phosphate-dehydrogenase Fragment [Source:UniProtKB/TrEMBL;Acc:Q6IWE3]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 11330475..11330531 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 78722326..78722382 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070443 (AC121959.3)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57383643..57383699 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078696 (AL772328.13)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 96291858..96291914 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078191 (AC148327.3-203) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q3TUZ9]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 60030226..60030282 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070025 (AC130841.4) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q3TUZ9]

 
Come back to gene ENSMUSG00000070025


For any suggestions or comments, please send an email to unitrap@crg.es