Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST32741
Clone ID OST32741
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST32741
Sequence
AGTAATCCTGTGACCTCAGTAGATGCTGACTGCTNGTGGCCGGNGCACTAGGGCAGAAAGGACTCCTGAAAGAACCTGAT
TTGCACANNACNANTTGNNGCTTTCAGGNGACANCNACAAGAACATCAAACAAGCGNNGTTTGGACGCNCANAAATTGAA
ATTGCTGAGCAAGAGATGCCTGCCTTGATGGCTTTAAGGAAGAGAGCCCAAGGAGAAAAGCCTTTGGCTGGAGCCAAAAT
TGTGGGTTGTACGCACATCACTGCTCAGACAGCCGTGCTTATGGAGACACTGGGTGCTCTGGGGGCACAGTGCCGATGGG
CTGCCTGCAACATCTACTNCACCCTCAATGAAGTGGC
Sequence Type mRNA
Unitrap ID UNI28364

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 29789541..29828611 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029772 (Ahcyl2) NM_021414 S-adenosylhomocysteine hydrolase-like 2 Gene [Source:MGI (curated);Acc:Ahcyl2-002]

 
Come back to gene ENSMUSG00000029772


For any suggestions or comments, please send an email to unitrap@crg.es