Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST32702
Clone ID OST32702
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST32702
Sequence
ATCATGTATGCCGCTGGNTCCAGGGGCCACTCCCCTGCTTTCCTGCAACCTNAAAACGGAAACGGCCACCGCTCACCTGG
TTATGTTCCCGGGAAGGTGGTTCCCTTACGTGCCGCGCCTCCTCCAAAGAACCACGCCTCCGCCAAACTGACCTCCAGGA
GCCAAGACGCCCCAGCGACCTTTGCTTTCTCCCCCGAGGAGCAGCGGACTCCGAGCGAGAGCCGAAAGCGGAAGAGGCAC
AAGAACACCTTCATCTGCTTCGCCATAACCAGCTTCTCGTTCTTTGTGGCGCTTGCGGTCATTTTGGGAATATCCTCAAA
ATACGCTCCAGATGAGAATTGTCCAGATCAAAACCCTCGTCTCAGGAACTGGGATCCAGGACAAGATTCTGCGAAGCACA
TTGTTATCAAGGAGGGG
Sequence Type mRNA
Unitrap ID UNI14461

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21867137..21871899 328
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024754 (Tmem2) NM_001033759 transmembrane protein 2 Gene [Source:MGI Symbol;Acc:MGI:1890373]

 
Come back to gene ENSMUSG00000024754


For any suggestions or comments, please send an email to unitrap@crg.es