Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST32606
Clone ID OST32606
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST32606
Sequence
TGTGAAATGGCTTTTCCCCGGGTCAAGCCAGCACCTGATGAGACCTCCTTCAGTGAAGCCTTGCTGAAGAGGAATCAAGA
CCTTGCCCCTAATTCTGCTGAGCAGGCTTCCATCCTTTCTTTGGTGACAAAAATCAACAATGTGATTGACAACTTGATTG
TGGCCCCAGGAACATTTGAAGTGCAAATTGAAGAAGTCCGGCAGGTAGGATCATATAAAAAGGGAACAATGACTACAGGA
CACAATGTGGCTGACCTGGTGGTAATACTAAAGATCCTGCCAACATTGGAAGCTGTTGCTGCCCTGGGGAACAAAGTCGT
GGAAAGCCTAAGGGCACAGGATCCCTCAGAAGTTTTGACCATGCTGACTAA
Sequence Type mRNA
Unitrap ID UNI22946

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 90284526..90288394 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001016 (Ilf2) NM_026374 interleukin enhancer binding factor 2 Gene [Source:MGI Symbol;Acc:MGI:1915031]

 
Come back to gene ENSMUSG00000001016


For any suggestions or comments, please send an email to unitrap@crg.es