Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST32605
Clone ID OST32605
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST32605
Sequence
GTTCTGGCTGCCCATGTGGCCCCCCGAAGGAGCATTTCCTCACCTCCATCTGCTAAGTATGGTGGGCGGCATACAGTGAC
TATGATCCCAGGGGATGGCATCGGCCCAGAGCTCATGTTGCATGTTAAGTCTGTATTCAGGCATGCATGTGTGCCGGTGG
ACTTTGAAGAGGTGCATGTAAGCTCCAACGCTGATGAGGAGGACATCCGCAATGCCATCATGGCCATCCGCCGGAACCGT
GTGGCCCTGAAGGGCAACATTGAAACAAATCATAACCTGCCACCATCCCACAAATCTCGAAACAACATCCTTCGCACCAG
CCTAGACCTCTATGCCAACGTCATCCACTGTAAGAGCCTGCCAGGAGTGGTGACCCGGCACAAGGACATAGACATCCTCA
TTGTACGGGAAAACACAGAAGGCGAGTACAGCAGCCTGGAGCATGAGAGCGTANCAGGAGTGGTGGAGAGCTTGAAGATT
ATCACCAAAGCCAAGTCCCTGCGCATTGCTGAATATGCTTTCAAGCTGGCCCAGGAGAGTGGNCGTAAGAAAGTGACGG
Sequence Type mRNA
Unitrap ID UNI10865

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 71025935..71028055 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002010 (Idh3g) NM_008323 isocitrate dehydrogenase 3 (NAD+), gamma Gene [Source:MGI (curated);Acc:Idh3g-001]

 
Come back to gene ENSMUSG00000002010


For any suggestions or comments, please send an email to unitrap@crg.es