Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST32358
Clone ID OST32358
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST32358
Sequence
ACTTTTCAGAAAAGAAGATGGACCAGCCTAGTGGGAGAAGTTTCATGCAAGTATTGTGTGAAAAATACAGTCCTGAAAAC
TTCCCTTACCGCCGTGGCCCTGGGGTGGGAGTCCATGTCCCAGCCACTCCCCAGGGCTCGCCTATGAAAGATCGCCTCAA
CCTCCCGAGCGTGCTCGTGTTGAACAGCTGCGGCATTACCTGCGCGGGAGATGAAAGAGAAATCGCAGCCTTCTGTGCTC
ACGTGTCAGAACTCGATCTTTCTGACAACAAGCTCCAAGACTGGCATGAGGTCAGTAAGATTGTGTCAAATGTTCCTCAG
CTGGAGTTTCTAAACCTGAGTTCCAATCCT
Sequence Type mRNA
Unitrap ID UNI22778

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42252612..42259845 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037287 (Tbcel) NM_173038 tubulin folding cofactor E-like Gene [Source:MGI Symbol;Acc:MGI:1925543]

 
Come back to gene ENSMUSG00000037287


For any suggestions or comments, please send an email to unitrap@crg.es