Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST32355
Clone ID OST32355
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST32355
Sequence
GATGAAAAAGCATTTGTAACTATGAATTGACTACAGTTTTCTTCTTCCTCCTTTCCTGNAATTCTGTNTCTTTCCTTTTG
TTCCTTCCTTGCTTGAGAGACTCAAAGCACCCGNGACTCTGNTNCCCCATTTACCCCCTTTTGAATTTGCACTAAGTCNA
TTGCACTGGTTTGGAGTCCCGGAGATAGCTTTGAGTCTCTCCGTATGAATGTATACAGCGAGTGTGTAAACCTCTTTGGC
AATGCTGCCCCAGTACCCACCTGTCGTCCATCTCCGTCTGAGGGCAACTGGGTGTGGCCGNGTGCTTGAGGCCTCGCCTT
CCCT
Sequence Type mRNA
Unitrap ID UNI28386

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 149761558..149761844 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000031 (H19) H19 fetal liver mRNA Gene [Source:MGI Symbol;Acc:MGI:95891]

 
Come back to gene ENSMUSG00000000031


For any suggestions or comments, please send an email to unitrap@crg.es