Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST32312
Clone ID OST32312
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST32312
Sequence
AGCCGACCTGTCCCGGACTCAGCATAACTAACGAAGCTGCTGCAGAATGANAAGATGGCAGCGCGGCTGCTCGCACCACC
AGGCCCCGACAGTTTCAAGCCTTTCACCCCCGAGTCGCTGGCAAACATCGAGAGGCGCATCGCCGAGAGCAAGCTCAAGA
AACCACCCAAGGCGGATGGCAGCCACCGGGAGGACGATGAAGACAGCAAGCCCAAGCCAAACAGTGACCTGGAGGCGGGG
AAGAGTTTGCCTTTCATCTACGGGGACATCCCGCAAGGCCTGGTTGCGGTTCCCCTGGAGGACTTTGACCCGTACTATTT
GACGCAAAAACC
Sequence Type mRNA
Unitrap ID UNI26909

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 100766702..100767031 326
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023033 (Scn8a) NP_001070967 sodium channel, voltage-gated, type VIII, alpha Gene [Source:MGI Symbol;Acc:MGI:103169]

 
Come back to gene ENSMUSG00000023033


For any suggestions or comments, please send an email to unitrap@crg.es