Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST32208
Clone ID OST32208
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST32208
Sequence
TTGGCATTAGGGAATGCTGCNCATNTAACGAAGCANCGCTTCCTGNNTNTGNNCCACCAGGGCNNGAANGTGGGAATCCT
ANATGTGGACCTGTGCGGTCCCANCATACCACACATGCTCCGTGCACAAGGCAAGGNCGTGCACCAGTGTGACAATGGCT
GGGTGCCTGTCTTTGTGGATCAGGAGCAGAGCATCTCCCTTATGTCTGTGGGGTTCCTGCTGGAAAACCCTGATGAGGCC
GTGGTGTGGAGAGGTCNCAAGAAACATGCACTGATAAAGCAGTTTGTGTCTGA
Sequence Type mRNA
Unitrap ID UNI28390

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 25021476..25022562 191
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039183 (Nubp2) NM_011956 nucleotide binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1347072]

 
Come back to gene ENSMUSG00000039183


For any suggestions or comments, please send an email to unitrap@crg.es