Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST32127
Clone ID OST32127
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST32127
Sequence
ATGTGAACACGGCTGTCTCATGTTTCTGCTGCAACGGTTATGAGCTGCTCCCATTGCTATGACTGACTGGGAGCCAACAC
AAATCGTCCTTCCCTACTACAGTTGTTTCTATCAGGTATTTTGTCAAAGCAACAGGTAAGGTGACTAAAACAACAGAAGT
CTTCAATTTTAATAAAGTCCAATCTCTTGGTTATTGACCTGGTGAGTACACTGGGTTTCTGTGTACATCTTATTAAAACT
TACCAGGACATTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI19521

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150179258..150179512 252
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052281 (OTTMUSG00000018795) predicted gene, OTTMUSG00000018795 Gene [Source:MGI Symbol;Acc:MGI:3705185]

 
Come back to gene ENSMUSG00000052281


For any suggestions or comments, please send an email to unitrap@crg.es