Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XG669
Clone ID XG669
Vector pGT1Lxf
Project baygenomics

Sequence tag XG669
Sequence
ATCTTGGATTCCGCGGTAGCGGTGGCGGCGGTAAGGTGCCTAATCTGCGGAGTGGCTCTTCCCTCCCCTCCCCCAGCTCG
GTGGCGGCTGCCCCTCCCACCGAGGGTGGCGCAGGGACGGTGCCATCTCGACCATGGCGGCGACTACAGCTAAC
Sequence Type mRNA
Unitrap ID UNI6298

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95238326..95238479 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015522 (Arnt) NM_009709 aryl hydrocarbon receptor nuclear translocator Gene [Source:MGI Symbol;Acc:MGI:88071]

 
Come back to gene ENSMUSG00000015522


For any suggestions or comments, please send an email to unitrap@crg.es