Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XG698
Clone ID XG698
Vector pGT1Lxf
Project baygenomics

Sequence tag XG698
Sequence
TTTTGGCTTAGCAAGATTAATTGAACACAATGAATTCACGGCAAGACAAGGTGCAAAATTTCCAATCAAGTGGACAGCTC
CTGAGGCTGCTCTGTATGGTCGATTTACAATAAAGTCACGATGTGTGGTCATTTGGAATTCTACAGACAGAGCTGGTAAC
AAAAGGAAGAGTGCCATAT
Sequence Type mRNA
Unitrap ID UNI9273

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 32963229..32966769 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014932 (Yes1) NM_009535 Yamaguchi sarcoma viral (v-yes) oncogene homolog 1 Gene [Source:MGI Symbol;Acc:MGI:99147]

 
Come back to gene ENSMUSG00000014932


For any suggestions or comments, please send an email to unitrap@crg.es