Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST31865
Clone ID OST31865
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST31865
Sequence
TCTATGACTACTTCTATGCCTTCCTGCGGCGGGAGTATTACCTCACACACGGCCTCTACTTGACTGCCAAGGACGGCACT
GAGGCCATGCTTGTGCTCAAGTAGCCCTGGCTGGCACAGCGCTGCATGGACAAGAGGGGGAAGGGCCAGAAGCTGGGCCA
GGTCCCTCATCCAGAGTTGCCAGCAGGCGCGTCCTCAGGCAGAAGAAGTTCAAGTCCAGGGTCACAAATCTCTGGCACCA
AAGGGGACTCATAGCTGGCAACAAGGCCCATGGGGAGAAGCTAGGAGCACCCCACTTGGACCCCCACTTTGTGACTGTGC
ACAGAAAGGAAGCAGCCGGTGAGCAGGGCTTTATAGGTTGTGACTACTTAATAAATGTGTGGATCTTTTTTTTTCAAAAA
AAAAAA
Sequence Type mRNA
Unitrap ID UNI28405

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 155103982..155104375 392
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038383 (Pigu) NM_001004721 phosphatidylinositol glycan anchor biosynthesis, class U Gene [Source:MGI (curated);Acc:Pigu-001]

 
Come back to gene ENSMUSG00000038383


For any suggestions or comments, please send an email to unitrap@crg.es